Summarize and collapse multiple mutational scanning experiments

Combine multiple sequence lists (as returned by digestFastqs into a SummarizedExperiment, with observed variable sequences (sequence pairs) in rows and samples in columns.

Usage

summarizeExperiment(x, coldata, countType = "umis")

Arguments

x: A named list of objects returned by digestFastqs. Names are used to link the objects to the metadata provided in coldata.
coldata: A data.frame with at least one column "Name", which will be used to link to objects in x. A potentially subset and reordered version of coldata is stored in the colData of the returned SummarizedExperiment.
countType: Either "reads" or "umis". If "reads", the "count" assay of the returned object will contain the observed number of reads for each sequence (pair). If "umis", the "count" assay will contain the number of unique UMIs observed for each sequence (pair).

Value

A SummarizedExperiment x with

assays(x)$counts: containing the observed number of sequences or sequence pairs (if countType = "reads"), or the observed number of unique UMIs for each sequence or sequence pair (if countType = "umis").
rowData(x): containing the unique sequences or sequence pairs.
colData(x): containing the metadata provided by coldata.

Author

Michael Stadler, Charlotte Soneson

Examples

## Input sample
inp <- digestFastqs(
    fastqForward = system.file("extdata", "cisInput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96), 
    constantForward = "AACCGGAGGAGGGAGCTG", 
    wildTypeForward = c(FOS = paste0("ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
                                     "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    nbrMutatedCodonsMaxForward = 1
)
## Output sample
outp <- digestFastqs(
    fastqForward = system.file("extdata", "cisOutput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96), 
    constantForward = "AACCGGAGGAGGGAGCTG", 
    wildTypeForward = c(FOS = paste0("ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
                                     "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    nbrMutatedCodonsMaxForward = 1
)
## Combine
se <- summarizeExperiment(
    x = list(r1inp = inp, r1outp = outp), 
    coldata = data.frame(Name = c("r1inp", "r1outp"), 
                         Condition = c("input", "output"), 
                         Replicate = c("rep1", "rep1")),
    countType = "umis"
)
se
#> class: SummarizedExperiment 
#> dim: 134 2 
#> metadata(4): parameters errorStatistics countType mutNameDelimiter
#> assays(1): counts
#> rownames(134): FOS.0.WT FOS.1.AAT ... FOS.9.GAA FOS.9.GAG
#> rowData names(19): mutantName sequence ... mutationTypes varLengths
#> colnames(2): r1inp r1outp
#> colData names(19): Name Condition ... f13_nbrTooManyBestConstantHits
#>   nbrRetained