Prepare input files for HOMER motif enrichment analysis.
Source:R/motif_enrichment_HOMER.R
prepareHomer.RdFor each bin, write genomic coordinates for foreground and background regions into files for HOMER motif enrichment analysis.
Usage
prepareHomer(
gr,
b,
genomedir,
outdir,
motifFile,
homerfile = findHomer(),
regionsize = "given",
Ncpu = 2L,
verbose = FALSE
)Arguments
- gr
A
GRangesobject (or an object that can be coerced to one) with the genomic regions to analyze.- b
A vector of the same length as
grthat groups its elements into bins (typically a factor).- genomedir
Directory containing sequence files in Fasta format (one per chromosome).
- outdir
A path specifying the folder into which the output files (two files per unique value of
b) will be written.- motifFile
A file with HOMER formatted PWMs to be used in the enrichment analysis.
- homerfile
Path and file name of the
findMotifsGenome.plHOMER script.- regionsize
The peak size to use in HOMER (
"given"keeps the coordinate region, an integer value will keep only that many bases in the region center).- Ncpu
Number of parallel threads that HOMER can use.
- verbose
A logical scalar. If
TRUE, print progress messages.
Details
For each bin (unique value of b) this functions creates two
files in outdir (outdir/bin_N_foreground.tab and
outdir/bin_N_background.tab, where N is the number of the
bin and foreground/background correspond to the ranges that are/are not
within the current bin). The files are in the HOMER peak file format
(see http://homer.ucsd.edu/homer/ngs/peakMotifs.html for details).
In addition, a shell script file is created containing the shell commands to run the HOMER motif enrichment analysis.
Examples
# prepare genome directory (here: one dummy chromosome)
genomedir <- tempfile()
dir.create(genomedir)
writeLines(c(">chr1", "ATGCATGCATCGATCGATCGATCGTACGTA"),
file.path(genomedir, "chr1.fa"))
# prepare motif file, regions and bins
motiffile <- tempfile()
dumpJaspar(filename = motiffile, pkg = "JASPAR2020",
opts = list(ID = c("MA0006.1")))
#> [1] TRUE
gr <- GenomicRanges::GRanges("chr1", IRanges::IRanges(1:4, width = 4))
b <- bin(1:4, nElements = 2)
# create dummy file (should point to local Homer installation)
homerfile <- file.path(tempdir(), "findMotifsGenome.pl")
writeLines("dummy", homerfile)
# run prepareHomer
outdir <- tempfile()
prepareHomer(gr = gr, b = b, genomedir = genomedir,
outdir = outdir, motifFile = motiffile,
homerfile = homerfile, verbose = TRUE)
#> ℹ creating foreground/background region files for HOMER
#> ✔ creating foreground/background region files for HOMER [5ms]
#>
#> ℹ bin [1,2.5]
#> ✔ bin (2.5,4] [14ms]
#>
#> ℹ bin (2.5,4]
#> ✔ bin (2.5,4] [17ms]
#>
#> [1] "/var/folders/8d/778wjbv96mq1760tv6gk374m0000gn/T//RtmpyV8oRz/filee7f739b27b12/run.sh"
list.files(outdir)
#> [1] "bin_001_background.tab" "bin_001_foreground.tab" "bin_002_background.tab"
#> [4] "bin_002_foreground.tab" "run.sh"
# clean up example
unlink(c(genomedir, motiffile, homerfile, outdir))